Propagation of CzcR2 regulog to Lactobacillus paracasei subsp. paracasei 8700:2

Reference regulog properties
Source regulog:	CzcR2 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:
Biological process:	Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus paracasei subsp. paracasei 8700:2
Orthologous TF(s)	Lparp8_010100011532
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Lactobacillus paracasei subsp. paracasei 8700:2*
	Locus tag	Position	Score	Sequence
Position: -78 Score: 6.1 Sequence: ATATGTTGACATATACATAT Locus tag: Lparp8_010100011527
	Lparp8_010100011527	-78	6.1	ATATGTTGACATATACATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: czcX
Ortholog function: Predicted cobalt-zinc-cadmium resistance protein
Lactobacillus rhamnosus GG	LGG_02417	-68	6	TTATGTTGACATTAACATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --