Propagation of CzcR2 regulog to Lactobacillus paracasei subsp. paracasei 8700:2
Source regulog: | CzcR2 - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | |
Biological process: | Zinc resistance; Cobalt resistance; Cadmium resistance |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus paracasei subsp. paracasei 8700:2 |
Orthologous TF(s) | Lparp8_010100011532 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -78
Score: 6.1 Sequence: ATATGTTGACATATACATAT
Locus tag: Lparp8_010100011527
|
||||
Lparp8_010100011527 | -78 | 6.1 | ATATGTTGACATATACATAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: czcX | ||||
Ortholog function: Predicted cobalt-zinc-cadmium resistance protein | ||||
Lactobacillus rhamnosus GG | LGG_02417 | -68 | 6 | TTATGTTGACATTAACATAT |