Propagation of MntR regulog to Lactobacillus paracasei subsp. paracasei 8700:2

Reference regulog properties
Source regulog:	MntR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus paracasei subsp. paracasei 8700:2
Orthologous TF(s)	Lparp8_010100014040
Regulated genes	2

Built upon 14 sites [see more]

Predicted regulatory interactions in *Lactobacillus paracasei subsp. paracasei 8700:2*
	Locus tag	Position	Score	Sequence
Position: -71 Score: 6.4 Sequence: AAGTTAGGGAGACCTAAAAG Locus tag: Lparp8_010100011497
	Lparp8_010100011497	-71	6.4	AAGTTAGGGAGACCTAAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Lactobacillus brevis ATCC 367	LVIS_0225	-19	5	AAGGAAGGGAGTCTTAAAAT
Lactobacillus casei ATCC 334	LSEI_2413	-71	6.4	AAGTTAGGGAGACCTAAAAG
Lactobacillus fermentum IFO 3956	LAF_1828	-91	4.8	TTTTTATGCTAACCTAACAA
Lactobacillus rhamnosus GG	LGG_02411	-72	6.4	AAGTTAGGGAGACCTAAAAG

Position: -32 Score: 5.9 Sequence: AAATTAGGTCACCCTAAAAA Locus tag: Lparp8_010100011547
	Lparp8_010100011547	-32	5.9	AAATTAGGTCACCCTAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntC
Ortholog function: Manganese ABC transporter, permease protein
Lactobacillus casei ATCC 334	LSEI_2423	-32	5.7	GAATTAGGTCACCCTAAAAA
Lactobacillus plantarum WCFS1	lp_1095	-82	5.2	AAGTTAACTGCACCTAACAA
Lactobacillus rhamnosus GG	LGG_02421	-31	5.6	GAATTAGGTCACCCTAAAAT
Lactobacillus sakei subsp. sakei 23K	LSA0180	-34	6.3	AAGTTAGGTATACCTAAAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --