Propagation of MntR regulog to Lactobacillus paracasei subsp. paracasei 8700:2
Source regulog: | MntR - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus paracasei subsp. paracasei 8700:2 |
Orthologous TF(s) | Lparp8_010100014040 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -71
Score: 6.4 Sequence: AAGTTAGGGAGACCTAAAAG
Locus tag: Lparp8_010100011497
|
||||
Lparp8_010100011497 | -71 | 6.4 | AAGTTAGGGAGACCTAAAAG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntH | ||||
Ortholog function: Manganese transport protein MntH | ||||
Lactobacillus brevis ATCC 367 | LVIS_0225 | -19 | 5 | AAGGAAGGGAGTCTTAAAAT |
Lactobacillus casei ATCC 334 | LSEI_2413 | -71 | 6.4 | AAGTTAGGGAGACCTAAAAG |
Lactobacillus fermentum IFO 3956 | LAF_1828 | -91 | 4.8 | TTTTTATGCTAACCTAACAA |
Lactobacillus rhamnosus GG | LGG_02411 | -72 | 6.4 | AAGTTAGGGAGACCTAAAAG |
Position: -32
Score: 5.9 Sequence: AAATTAGGTCACCCTAAAAA
Locus tag: Lparp8_010100011547
|
||||
Lparp8_010100011547 | -32 | 5.9 | AAATTAGGTCACCCTAAAAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntC | ||||
Ortholog function: Manganese ABC transporter, permease protein | ||||
Lactobacillus casei ATCC 334 | LSEI_2423 | -32 | 5.7 | GAATTAGGTCACCCTAAAAA |
Lactobacillus plantarum WCFS1 | lp_1095 | -82 | 5.2 | AAGTTAACTGCACCTAACAA |
Lactobacillus rhamnosus GG | LGG_02421 | -31 | 5.6 | GAATTAGGTCACCCTAAAAT |
Lactobacillus sakei subsp. sakei 23K | LSA0180 | -34 | 6.3 | AAGTTAGGTATACCTAAAAG |