Propagation of CcpN regulog to Lactobacillus paracasei subsp. paracasei 8700:2

Reference regulog properties
Source regulog:	CcpN - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CcpN
Regulation mode:	repressor
Biological process:	Gluconeogenesis
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus paracasei subsp. paracasei 8700:2
Orthologous TF(s)	Lparp8_010100011197
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Lactobacillus paracasei subsp. paracasei 8700:2*
	Locus tag	Position	Score	Sequence
Position: -66 Score: 5 Sequence: TTCAAAAATAATACATTATAA Locus tag: Lparp8_010100011192
	Lparp8_010100011192	-66	5	TTCAAAAATAATACATTATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppdK
Ortholog function: Pyruvate phosphate dikinase (EC 2.7.9.1)
Lactobacillus casei ATCC 334	LSEI_2334	-196	4.7	TTTTTAAATATCTCATTGAAA
		-66	5	TTCAAAAATAATACATTATAA
Lactobacillus rhamnosus GG	LGG_02351	-66	4.7	CTGCTAAATAATACATTATAT
Lactobacillus sakei subsp. sakei 23K	LSA1141	-55	5.4	TTGTAATGTGACACACTATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --