Propagation of Lp_3221 regulog to Lactobacillus paracasei subsp. paracasei 8700:2

Reference regulog properties
Source regulog:	Lp_3221 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus paracasei subsp. paracasei 8700:2
Orthologous TF(s)	Lparp8_010100010020, Lparp8_010100012799
Regulated genes	2

Built upon 6 sites [see more]

Predicted regulatory interactions in *Lactobacillus paracasei subsp. paracasei 8700:2*
	Locus tag	Position	Score	Sequence
Position: -58 Score: 6.6 Sequence: ATATGGAATCGATACCATAT Locus tag: Lparp8_010100010015
	Lparp8_010100010015	-58	6.6	ATATGGAATCGATACCATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: agl4
Ortholog function: Oligo-1,6-glucosidase
Lactobacillus casei ATCC 334	LSEI_2102	-58	6.5	ATATGGAATCGATACCACAT
Lactobacillus plantarum WCFS1	lp_3220	-35	6.4	AAGTGGAATCGATTCCAAAT
Lactobacillus rhamnosus GG	LGG_02105	-39	6.5	ATATGGAATCGATACCACAT

Position: -36 Score: 6.4 Sequence: CTATGAAATCGATTCCATAT Locus tag: Lparp8_010100010020
	Lparp8_010100010020	-36	6.4	CTATGAAATCGATTCCATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lp_3221
Ortholog function: Predicted sugar utilization transcriptional regulator, LacI family
Lactobacillus casei ATCC 334	LSEI_2103	-37	6.3	CTATGAAATCGATTCCATAC
Lactobacillus plantarum WCFS1	lp_3221	-36	6.2	TTATGGAAACGATTCCAAAC
Lactobacillus rhamnosus GG	LGG_02106	-38	6.3	GTATGAAATCGATTCCATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --