Propagation of FlpA regulog to Lactobacillus plantarum WCFS1
| Source regulog: | FlpA - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Heavy metal resistance |
| Effector: | Oxygen |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus plantarum WCFS1 |
| Orthologous TF(s) | lp_1442, lp_3444 |
| Regulated genes | 4 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -31
Score: 5.3 Sequence: AAATTGACATAAATCAAGAA
Locus tag: lp_1442
|
||||
| lp_1442 | -31 | 5.3 | AAATTGACATAAATCAAGAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: flpA | ||||
| Ortholog function: Heavy metal resistance transcriptional regulator FlpA, Crp family | ||||
| Lactobacillus plantarum WCFS1 | lp_1442 | -31 | 5.3 | AAATTGACATAAATCAAGAA |
|
Position: -78
Score: 6.1 Sequence: AACTTGACGCCTATCAAGTT
Locus tag: lp_3435
|
||||
| lp_3435 | -78 | 6.1 | AACTTGACGCCTATCAAGTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cadA | ||||
| Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-) | ||||
| Lactobacillus acidophilus NCFM | LBA0541 | -75 | 5.4 | ATCTTGATAACAGTCAAGTC |
| Lactobacillus casei ATCC 334 | LSEI_0070 | -68 | 4.8 | AAGTTGATCACCGTCAAGGC |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | LBUL_0427 | -77 | 5.3 | ATCTTGATAGAAATCAATTG |
| Lactobacillus fermentum IFO 3956 | LAF_1702 | -69 | 5.2 | CTCTTGATTCCGATCAATTT |
| Lactobacillus johnsonii NCC 533 | LJ1696 | -75 | 5.2 | ATCTTGATAATAGTCAAGTC |
| Lactobacillus plantarum WCFS1 | lp_3435 | -78 | 6.1 | AACTTGACGCCTATCAAGTT |
| Lactobacillus rhamnosus GG | LGG_00082 | -68 | 5.3 | AAATTGATCCCGGTCAAGGT |
| Lactobacillus sakei subsp. sakei 23K | LSA1784 | -75 | 6.3 | AACTTGATGGCTATCAAGTT |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1786 | -210 | 5.6 | AACTTGATAGCCATAAATTT |
| -88 | 5.7 | AACTTGATGTCAGTCAATTA | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_A03 | -76 | 6.3 | AACTTGATGGACGTCAAGTT |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0411 | -75 | 5.7 | AAATTGACCTACGTCAATTT |
|
Position: -75
Score: 6 Sequence: TTCTTGACGGCCGTCAAGTT
Locus tag: lp_3442
|
||||
| lp_3442 | -75 | 6 | TTCTTGACGGCCGTCAAGTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: copZ | ||||
| Ortholog function: Copper chaperone | ||||
| Lactobacillus acidophilus NCFM | LBA0542 | -81 | 6 | AAATTGACGATCATCAAGTT |
| Lactobacillus casei ATCC 334 | LSEI_0071 | -76 | 5.4 | AACTTGACGACGATCAAGGA |
| Lactobacillus fermentum IFO 3956 | LAF_1701 | -68 | 5.1 | AAGTTGATGAGGATCAATTA |
| Lactobacillus johnsonii NCC 533 | LJ1695 | -82 | 6 | AAATTGACGATCATCAAGTT |
| Lactobacillus plantarum WCFS1 | lp_3442 | -75 | 6 | TTCTTGACGGCCGTCAAGTT |
| Lactobacillus reuteri JCM 1112 | LAR_1340 | -69 | 5.7 | AAATTGATGATAATCAATTT |
| Lactobacillus rhamnosus GG | LGG_00083 | -76 | 6 | AACTTGACGGCCATCAAGGT |
| Lactobacillus sakei subsp. sakei 23K | LSA1783 | -79 | 6.1 | AACTTGATGGCGATCAATTT |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1784 | -129 | 5.9 | AACTTGATATGCGTCAATTT |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_A04 | -66 | 5.2 | TAATTGATCTATATCAAGTA |
| Oenococcus oeni PSU-1 | OEOE_0354 | -126 | 6 | TTCTTGACGGCCGTCAAGTT |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0409 | -75 | 5.7 | AAATTGACCTACGTCAATTT |
|
Position: -142
Score: 6 Sequence: AACTTGACGGCCGTCAAGAA
Locus tag: lp_3444
|
||||
| lp_3444 | -142 | 6 | AACTTGACGGCCGTCAAGAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: flpA | ||||
| Ortholog function: Heavy metal resistance transcriptional regulator FlpA, Crp family | ||||
| Lactobacillus plantarum WCFS1 | lp_3444 | -142 | 6 | AACTTGACGGCCGTCAAGAA |
| Oenococcus oeni PSU-1 | OEOE_0355 | -142 | 6 | AACTTGACGGCCGTCAAGAA |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0408 | -74 | 5.7 | AAATTGACGTAGGTCAATTT |