Propagation of TreR regulog to Lactobacillus plantarum WCFS1

Reference regulog properties
Source regulog:	TreR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus plantarum WCFS1
Orthologous TF(s)	lp_2924, lp_0262
Regulated genes	1

Built upon 21 sites [see more]

Predicted regulatory interactions in *Lactobacillus plantarum WCFS1*
	Locus tag	Position	Score	Sequence
Position: -59 Score: 5.6 Sequence: CAACTTGTCTAAACAAGTCT Locus tag: lp_0262
	lp_0262	-59	5.6	CAACTTGTCTAAACAAGTCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treR
Ortholog function: Trehalose utilization transcriptional regulator TreR, GntR family
Lactobacillus acidophilus NCFM	LBA1013	-134	6.6	AAACTTGTATATACAAGTTG
		-56	5.2	TTACTTGTCTATACATTTAT
Lactobacillus casei ATCC 334	LSEI_0629	-61	5.2	ATACCTGTACGTACAGGTAA
Lactobacillus johnsonii NCC 533	LJ0759	39	5.9	ATACTTGTCTGTACAAGTTG
Lactobacillus plantarum WCFS1	lp_0262	-59	5.6	CAACTTGTCTAAACAAGTCT
Lactobacillus rhamnosus GG	LGG_00601	-61	5.6	ATACCTGTACGTACAAGTAG
Lactobacillus sakei subsp. sakei 23K	LSA1201	-113	6.1	CAACATGTATAGACAAGTTG
Lactobacillus salivarius subsp. salivarius UCC118	LSL_1513	-162	6.3	TCACTTGTATATACAAGTTG
Pediococcus pentosaceus ATCC 25745	PEPE_1805	-142	6.2	AAACTTGTATATACAAGATG
		-66	5.7	TACCTTGTATATACTAGTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --