Propagation of PadR regulog to Lactobacillus plantarum WCFS1

Reference regulog properties
Source regulog:	PadR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	p-Coumaric acid; Ferulic acid
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus plantarum WCFS1
Orthologous TF(s)	lp_3079, lp_3664
Regulated genes	2

Built upon 6 sites [see more]

Predicted regulatory interactions in *Lactobacillus plantarum WCFS1*
	Locus tag	Position	Score	Sequence
Position: -80 Score: 6.9 Sequence: AATCATGTAATTTATTACATGTTT Locus tag: lp_3664
	lp_3664	-80	6.9	AATCATGTAATTTATTACATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padR
Ortholog function: Phenolic acid stress response transcriptional regulator PadR, PadR family
Lactobacillus brevis ATCC 367	LVIS_0214	-208	7.1	GAACATGTAATTAATTACATGTTT
Lactobacillus plantarum WCFS1	lp_3664	-80	6.9	AATCATGTAATTTATTACATGTTT
Pediococcus pentosaceus ATCC 25745	PEPE_0492	7	6.4	AAACTTTTAAAACTTTAGATGACT

Position: -59 Score: 7.5 Sequence: AAACATGTAATAAATTACATGATT Locus tag: lp_3665
	lp_3665	-59	7.5	AAACATGTAATAAATTACATGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padC
Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-)
Lactobacillus brevis ATCC 367	LVIS_0213	-48	7.1	AAACATGTAATTAATTACATGTTC
Lactobacillus plantarum WCFS1	lp_3665	-59	7.5	AAACATGTAATAAATTACATGATT
Lactobacillus sakei subsp. sakei 23K	LSA1701	-41	7.2	AAACATGTAATTAATTACATGATA
Pediococcus pentosaceus ATCC 25745	PEPE_0491	7	6.4	AAACTTTTAAAACTTTAGATGACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --