Propagation of NrtR regulog to Lactobacillus plantarum WCFS1

Reference regulog properties
Source regulog:	NrtR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus plantarum WCFS1
Orthologous TF(s)	lp_2515
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Lactobacillus plantarum WCFS1*
	Locus tag	Position	Score	Sequence
Position: -61 Score: 5.8 Sequence: TAAAGGTAAAAAATACCTAAA Locus tag: lp_2514
	lp_2514	-61	5.8	TAAAGGTAAAAAATACCTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaP
Ortholog function: Niacin transporter NiaP
Lactobacillus plantarum WCFS1	lp_2514	-61	5.8	TAAAGGTAAAAAATACCTAAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0911	-40	6.4	TAAAAGTAAAAAATACTTTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --