Propagation of NrtR regulog to Lactobacillus plantarum WCFS1
| Source regulog: | NrtR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus plantarum WCFS1 |
| Orthologous TF(s) | lp_2515 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -61
Score: 5.8 Sequence: TAAAGGTAAAAAATACCTAAA
Locus tag: lp_2514
|
||||
| lp_2514 | -61 | 5.8 | TAAAGGTAAAAAATACCTAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: niaP | ||||
| Ortholog function: Niacin transporter NiaP | ||||
| Lactobacillus plantarum WCFS1 | lp_2514 | -61 | 5.8 | TAAAGGTAAAAAATACCTAAA |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_0911 | -40 | 6.4 | TAAAAGTAAAAAATACTTTTA |