Propagation of Lp_3221 regulog to Lactobacillus plantarum WCFS1

Reference regulog properties
Source regulog:	Lp_3221 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus plantarum WCFS1
Orthologous TF(s)	lp_3221
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Lactobacillus plantarum WCFS1*
	Locus tag	Position	Score	Sequence
Position: -35 Score: 6.4 Sequence: AAGTGGAATCGATTCCAAAT Locus tag: lp_3220
	lp_3220	-35	6.4	AAGTGGAATCGATTCCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: agl4
Ortholog function: Oligo-1,6-glucosidase
Lactobacillus casei ATCC 334	LSEI_2102	-58	6.5	ATATGGAATCGATACCACAT
Lactobacillus plantarum WCFS1	lp_3220	-35	6.4	AAGTGGAATCGATTCCAAAT
Lactobacillus rhamnosus GG	LGG_02105	-39	6.5	ATATGGAATCGATACCACAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --