Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PadR regulog to Pediococcus pentosaceus ATCC 25745

Reference regulog properties
Source regulog: PadR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: p-Coumaric acid; Ferulic acid
Phylum: Firmicutes
Propagated regulon:
Target genome Pediococcus pentosaceus ATCC 25745
Orthologous TF(s) PEPE_0492
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Pediococcus pentosaceus ATCC 25745
Locus tag Position Score Sequence
Position: 7
Score: 6.4
Sequence: AAACTTTTAAAACTTTAGATGACT
Locus tag: PEPE_0491
PEPE_0491 7 6.4 AAACTTTTAAAACTTTAGATGACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padC
Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-)
Lactobacillus brevis ATCC 367 LVIS_0213 -48 7.1 AAACATGTAATTAATTACATGTTC
Lactobacillus plantarum WCFS1 lp_3665 -59 7.5 AAACATGTAATAAATTACATGATT
Lactobacillus sakei subsp. sakei 23K LSA1701 -41 7.2 AAACATGTAATTAATTACATGATA
Pediococcus pentosaceus ATCC 25745 PEPE_0491 7 6.4 AAACTTTTAAAACTTTAGATGACT