Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NrtR regulog to Lactobacillus plantarum JDM1

Reference regulog properties
Source regulog: NrtR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode:
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus plantarum JDM1
Orthologous TF(s) JDM1_2026
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Lactobacillus plantarum JDM1
Locus tag Position Score Sequence
Position: -61
Score: 5.8
Sequence: TAAAGGTAAAAAATACCTAAA
Locus tag: JDM1_2025
JDM1_2025 -61 5.8 TAAAGGTAAAAAATACCTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaP
Ortholog function: Niacin transporter NiaP
Lactobacillus plantarum WCFS1 lp_2514 -61 5.8 TAAAGGTAAAAAATACCTAAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 LEUM_0911 -40 6.4 TAAAAGTAAAAAATACTTTTA