Propagation of MtlR regulog to Lactobacillus rhamnosus GG

Reference regulog properties
Source regulog:	MtlR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannitol utilization
Effector:	HPr, phosphocarrier protein; MtlA, mannitol-specific enzyme IICB PTS component
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus rhamnosus GG
Orthologous TF(s)	LGG_02911
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Lactobacillus rhamnosus GG*
	Locus tag	Position	Score	Sequence
Position: -96 Score: 7.2 Sequence: TTTGGCACAACTAACTGTGCCAAA Locus tag: LGG_02912
	LGG_02912	-96	7.2	TTTGGCACAACTAACTGTGCCAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlA
Ortholog function: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
Lactobacillus casei ATCC 334	LSEI_2888	-96	7.5	TTTGGCACAGACAACTGTGCCAAA
Lactobacillus plantarum WCFS1	lp_0230	-104	6.7	TGTGGCACAGTTTCCTGTGCCACG
Lactobacillus rhamnosus GG	LGG_02912	-96	7.2	TTTGGCACAACTAACTGTGCCAAA
Lactobacillus salivarius subsp. salivarius UCC118	LSL_1620	-110	6.9	TTTGACACTGACAACTGTGCCAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --