Propagation of NrtR regulog to Lactobacillus rhamnosus GG
| Source regulog: | NrtR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus rhamnosus GG |
| Orthologous TF(s) | LGG_02763 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -41
Score: 6.5 Sequence: TTTAAGTAAATTTTACTTTAA
Locus tag: LGG_02764
|
||||
| LGG_02764 | -41 | 6.5 | TTTAAGTAAATTTTACTTTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pncA | ||||
| Ortholog function: Nicotinamidase (EC 3.5.1.19) | ||||
| Lactobacillus casei ATCC 334 | LSEI_2767 | -40 | 6.3 | TTTAAGTAAAAAATACTTTTA |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | LBUL_0279 | -55 | 6 | TTTAGGTAAGTTATACTTTTA |
| Lactobacillus fermentum IFO 3956 | LAF_1390 | -54 | 6 | TTTAGGTATTTTTTACTTTAA |
| Lactobacillus helveticus DPC 4571 | lhv_0929 | -74 | 6 | TAAAAGTAACTTAGACTTTTA |
| Lactobacillus reuteri JCM 1112 | LAR_0149 | -75 | 6.1 | TAAAAGTTAATCATACTTTTA |
| Lactobacillus rhamnosus GG | LGG_02764 | -41 | 6.5 | TTTAAGTAAATTTTACTTTAA |