Propagation of NiaR regulog to Lactobacillus rhamnosus GG
| Source regulog: | NiaR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus rhamnosus GG |
| Orthologous TF(s) | LGG_00791 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -51
Score: 5.6 Sequence: TTAGGGTGTCAAGACACCTAAT
Locus tag: LGG_02281
|
||||
| LGG_02281 | -51 | 5.6 | TTAGGGTGTCAAGACACCTAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: niaP | ||||
| Ortholog function: Niacin transporter NiaP | ||||
| Lactobacillus casei ATCC 334 | LSEI_2277 | -45 | 5 | CTAGGGTGTCAAGACACCCTAA |
| Lactobacillus rhamnosus GG | LGG_02281 | -51 | 5.6 | TTAGGGTGTCAAGACACCTAAT |
| Lactobacillus sakei subsp. sakei 23K | LSA1529 | -76 | 5.9 | TTAAGGTGTGTTGACACCTGTA |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0213 | -112 | 5.6 | TACAAGTGTCAAGACATTAATT |