Propagation of FlpA regulog to Lactobacillus rhamnosus Lc 705
Source regulog: | FlpA - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | CRP |
Regulation mode: | activator (repressor) |
Biological process: | Heavy metal resistance |
Effector: | Oxygen |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus rhamnosus Lc 705 |
Orthologous TF(s) | LC705_00074 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -69
Score: 5.2 Sequence: AAGTTGATTGCGGTCAAGGT
Locus tag: LC705_00071
|
||||
LC705_00071 | -69 | 5.2 | AAGTTGATTGCGGTCAAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cadA | ||||
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-) | ||||
Lactobacillus acidophilus NCFM | LBA0541 | -75 | 5.4 | ATCTTGATAACAGTCAAGTC |
Lactobacillus casei ATCC 334 | LSEI_0070 | -68 | 4.8 | AAGTTGATCACCGTCAAGGC |
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | LBUL_0427 | -77 | 5.3 | ATCTTGATAGAAATCAATTG |
Lactobacillus fermentum IFO 3956 | LAF_1702 | -69 | 5.2 | CTCTTGATTCCGATCAATTT |
Lactobacillus johnsonii NCC 533 | LJ1696 | -75 | 5.2 | ATCTTGATAATAGTCAAGTC |
Lactobacillus plantarum WCFS1 | lp_3435 | -78 | 6.1 | AACTTGACGCCTATCAAGTT |
Lactobacillus rhamnosus GG | LGG_00082 | -68 | 5.3 | AAATTGATCCCGGTCAAGGT |
Lactobacillus sakei subsp. sakei 23K | LSA1784 | -75 | 6.3 | AACTTGATGGCTATCAAGTT |
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1786 | -210 | 5.6 | AACTTGATAGCCATAAATTT |
-88 | 5.7 | AACTTGATGTCAGTCAATTA | ||
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_A03 | -76 | 6.3 | AACTTGATGGACGTCAAGTT |
Pediococcus pentosaceus ATCC 25745 | PEPE_0411 | -75 | 5.7 | AAATTGACCTACGTCAATTT |