Propagation of YtrA regulog to Lactobacillus rhamnosus Lc 705
Source regulog: | YtrA - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Hypothetical ABC transporter |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus rhamnosus Lc 705 |
Orthologous TF(s) | LC705_02234 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -46
Score: 6.7 Sequence: GTGTACTGCGTATAATAGTACAC
Locus tag: LC705_02234
|
||||
LC705_02234 | -46 | 6.7 | GTGTACTGCGTATAATAGTACAC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ytrA | ||||
Ortholog function: Predicted transcriptional regulator, GntR family | ||||
Lactobacillus brevis ATCC 367 | LVIS_0408 | -60 | 6.7 | GTGTACTAGGTATAATAGTACAG |
Lactobacillus plantarum WCFS1 | lp_1959 | -49 | 6.3 | GTGTACTAGTTGTAGTAATACAC |
Lactobacillus rhamnosus GG | LGG_02246 | -46 | 6.7 | GTGTACTGCGTATAATAGTACAC |
Lactobacillus sakei subsp. sakei 23K | LSA1419 | -61 | 6.8 | GTGTACTACGTATAATAGTACAG |
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_0050 | -123 | 6.6 | GTGTACTGTGTATTATAGTACAC |