Propagation of MtlR regulog to Lactobacillus rhamnosus Lc 705
Source regulog: | MtlR - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | BglG |
Regulation mode: | activator |
Biological process: | Mannitol utilization |
Effector: | HPr, phosphocarrier protein; MtlA, mannitol-specific enzyme IICB PTS component |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus rhamnosus Lc 705 |
Orthologous TF(s) | LC705_02875 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -96
Score: 7.2 Sequence: TTTGGCACAACTAACTGTGCCAAA
Locus tag: LC705_02876
|
||||
LC705_02876 | -96 | 7.2 | TTTGGCACAACTAACTGTGCCAAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mtlA | ||||
Ortholog function: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69) | ||||
Lactobacillus casei ATCC 334 | LSEI_2888 | -96 | 7.5 | TTTGGCACAGACAACTGTGCCAAA |
Lactobacillus plantarum WCFS1 | lp_0230 | -104 | 6.7 | TGTGGCACAGTTTCCTGTGCCACG |
Lactobacillus rhamnosus GG | LGG_02912 | -96 | 7.2 | TTTGGCACAACTAACTGTGCCAAA |
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1620 | -110 | 6.9 | TTTGACACTGACAACTGTGCCAAA |