Propagation of YxeR regulog to Lactobacillus helveticus DPC 4571

Reference regulog properties
Source regulog:	YxeR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus helveticus DPC 4571
Orthologous TF(s)	lhv_1880
Regulated genes	1

Built upon 20 sites [see more]

Predicted regulatory interactions in *Lactobacillus helveticus DPC 4571*
	Locus tag	Position	Score	Sequence
Position: -80 Score: 4.5 Sequence: GTATTGACAATGCGTCACAAA Locus tag: lhv_1880
	lhv_1880	-80	4.5	GTATTGACAATGCGTCACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yxeR
Ortholog function: Predicted antibiotic resistance transcriptional reguator, TetR family
Lactobacillus acidophilus NCFM	LBA1840	-81	3.6	TTATTGACAACTCGTCACAAT
Lactobacillus helveticus DPC 4571	lhv_1880	-80	4.5	GTATTGACAATGCGTCACAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --