Propagation of MdxR regulog to Lactobacillus helveticus DPC 4571
| Source regulog: | MdxR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | activator |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus helveticus DPC 4571 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -63
Score: 5.6 Sequence: TTTTGATACCGGTAACATCC
Locus tag: lhv_2002
|
||||
| lhv_2002 | -63 | 5.6 | TTTTGATACCGGTAACATCC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: malL | ||||
| Ortholog function: Oligo-1,6-glucosidase (EC 3.2.1.10) | ||||
| Lactobacillus acidophilus NCFM | LBA1872 | -78 | 5.4 | TTTTGATACCGCTAACATCT |
| Lactobacillus casei ATCC 334 | LSEI_0980 | -82 | 5.4 | TTTTGATAACGGTAACAAAC |
| Lactobacillus helveticus DPC 4571 | lhv_2002 | -63 | 5.6 | TTTTGATACCGGTAACATCC |
| Lactobacillus johnsonii NCC 533 | LJ0211 | -81 | 5.5 | TTTTGATACCGGTAACAGAT |