Propagation of CggR regulog to Lactobacillus helveticus DPC 4571
| Source regulog: | CggR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | SorC |
| Regulation mode: | repressor |
| Biological process: | Glycolysis |
| Effector: | Fructose-1,6-bisphosphate |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus helveticus DPC 4571 |
| Orthologous TF(s) | lhv_0742 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: 1
Score: 7.9 Sequence: TGAATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC
Locus tag: lhv_0742
|
||||
| lhv_0742 | 1 | 7.9 | TGAATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cggR | ||||
| Ortholog function: Transcriptional regulator of central glycolytic gene, SorC family | ||||
| Lactobacillus acidophilus NCFM | LBA0697 | 1 | 8 | TGGATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC |
| Lactobacillus brevis ATCC 367 | LVIS_0660 | 1 | 6.5 | TGCATGAGGATTGGCAATGGGTAGAGGCCATCATGCC |
| Lactobacillus casei ATCC 334 | LSEI_0966 | 1 | 7.6 | TGCATACTGAACTTGCGTGGCTCAAAGCGATCGCGCC |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | LBUL_0566 | 1 | 6.9 | TGAACACGGATTTATCCCTGCTCGAACTGCTTGTTCC |
| Lactobacillus helveticus DPC 4571 | lhv_0742 | 1 | 7.9 | TGAATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC |
| Lactobacillus johnsonii NCC 533 | LJ0871 | 1 | 6.1 | TGGACTCGGATTTAACCTTGTTGCAAAGCTTAGTTCC |
| Lactobacillus plantarum WCFS1 | lp_0788 | 1 | 6.7 | TGCATTCAGATATTCAATGGATTGAGGCAATTGCCCC |
| Lactobacillus rhamnosus GG | LGG_00932 | 1 | 7.6 | TGCATACTGAACTTGCGTGGCTCAAAGCGATCGCGCC |
| Lactobacillus sakei subsp. sakei 23K | LSA0603 | 1 | 6.5 | TGCGCGATGAGTTATCTGCAATAGAAGCGGTTGCGCC |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1167 | 1 | 6.8 | TGCGCGAGGAAGTAGAGTTGATTGAGTCAATCGTTCC |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0458 | 4 | 6 | ATGATAATGAGATGGATTTATTAGAATCTGTTGTTCC |