Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MalR regulog to Leuconostoc citreum KM20

Reference regulog properties
Source regulog: MalR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Propagated regulon:
Target genome Leuconostoc citreum KM20
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 11 sites [see more]
Predicted regulatory interactions in Leuconostoc citreum KM20
Locus tag Position Score Sequence
Position: -188
Score: 5.4
Sequence: TTGTGAAAACGCTTCCATCA
Locus tag: LCK_p200026
LCK_p200026 -188 5.4 TTGTGAAAACGCTTCCATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malT
Ortholog function: Predicted maltose/maltodextrin permease
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 LEUM_0893 -43 5.5 CAATGTAAACGGTTACAAAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 LEUM_0994 -186 6.1 TTGTGCAAACGCTTCCATTA
© 2009-2020 RegPrecise