Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RbsR regulog to Lactobacillus reuteri 100-23

Reference regulog properties
Source regulog: RbsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus reuteri 100-23
Orthologous TF(s) Lreu23DRAFT_0801
Regulated genes 1
Built upon 18 sites [see more]
Predicted regulatory interactions in Lactobacillus reuteri 100-23
Locus tag Position Score Sequence
Position: -35
Score: 4.7
Sequence: TAGATAAAACTGTTTACTAA
Locus tag: Lreu23DRAFT_0801
Lreu23DRAFT_0801 -35 4.7 TAGATAAAACTGTTTACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbsR
Ortholog function: Transcriptional repressor of ribose utilization, LacI family
Lactobacillus casei ATCC 334 LSEI_0306 -45 6.7 TAAGTAAAACGTTTTACCTA
Lactobacillus fermentum IFO 3956 LAF_1343 -44 6 TTAGTAAACTGTTTTATTAA
Lactobacillus reuteri JCM 1112 LAR_1219 -35 4.7 TAGATAAAACTGTTTACTAA
Lactobacillus rhamnosus GG LGG_00372 -46 6.7 TAAGTAAAACGTTTTACCTA
Lactobacillus sakei subsp. sakei 23K LSA0203 -49 6.9 TTAGTAAAACGTTTTACTAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 LEUM_0795 -123 6.6 TTAGTAAAACGTTTAACCAA
Oenococcus oeni PSU-1 OEOE_0146 -47 5.1 TGTTGTAAACGTTTTAAGAA
© 2009-2020 RegPrecise