Propagation of RbsR regulog to Lactobacillus reuteri 100-23
| Source regulog: | RbsR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus reuteri 100-23 |
| Orthologous TF(s) | Lreu23DRAFT_0801 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -35
Score: 4.7 Sequence: TAGATAAAACTGTTTACTAA
Locus tag: Lreu23DRAFT_0801
|
||||
| Lreu23DRAFT_0801 | -35 | 4.7 | TAGATAAAACTGTTTACTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: rbsR | ||||
| Ortholog function: Transcriptional repressor of ribose utilization, LacI family | ||||
| Lactobacillus casei ATCC 334 | LSEI_0306 | -45 | 6.7 | TAAGTAAAACGTTTTACCTA |
| Lactobacillus fermentum IFO 3956 | LAF_1343 | -44 | 6 | TTAGTAAACTGTTTTATTAA |
| Lactobacillus reuteri JCM 1112 | LAR_1219 | -35 | 4.7 | TAGATAAAACTGTTTACTAA |
| Lactobacillus rhamnosus GG | LGG_00372 | -46 | 6.7 | TAAGTAAAACGTTTTACCTA |
| Lactobacillus sakei subsp. sakei 23K | LSA0203 | -49 | 6.9 | TTAGTAAAACGTTTTACTAA |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_0795 | -123 | 6.6 | TTAGTAAAACGTTTAACCAA |
| Oenococcus oeni PSU-1 | OEOE_0146 | -47 | 5.1 | TGTTGTAAACGTTTTAAGAA |