Propagation of MntR regulog to Lactobacillus reuteri 100-23
| Source regulog: | MntR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus reuteri 100-23 |
| Orthologous TF(s) | Lreu23DRAFT_0145 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -89
Score: 4.8 Sequence: TTTTTATGTTACCCTAACAA
Locus tag: Lreu23DRAFT_0985
|
||||
| Lreu23DRAFT_0985 | -89 | 4.8 | TTTTTATGTTACCCTAACAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntH | ||||
| Ortholog function: Manganese transport protein MntH | ||||
| Lactobacillus reuteri JCM 1112 | LAR_1743 | -89 | 4.8 | TTTTTATGTTACCCTAACAA |