Propagation of MalR regulog to Lactobacillus reuteri 100-23
| Source regulog: | MalR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus reuteri 100-23 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -124
Score: 6.3 Sequence: TTGCGCAAGCGGTTGCACAA
Locus tag: Lreu23DRAFT_1693
|
||||
| Lreu23DRAFT_1693 | -124 | 6.3 | TTGCGCAAGCGGTTGCACAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: malT | ||||
| Ortholog function: Predicted maltose/maltodextrin permease | ||||
| Lactobacillus brevis ATCC 367 | LVIS_0357 | -93 | 6.2 | TTGCGCAATCGGTTGCATTA |
| Lactobacillus fermentum IFO 3956 | LAF_0024 | -122 | 6.6 | TTGTGCAAACGGTTGCACAA |
| Lactobacillus reuteri JCM 1112 | LAR_0051 | -124 | 6 | TTGCGCAAGCGGTTGCGCAA |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1282 | -117 | 6.3 | TATCGCAAACGGTTGCAAAA |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0968 | -86 | 6.1 | AAGTGCAAACGCTTGCACAA |