Propagation of FlpA regulog to Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842

Reference regulog properties
Source regulog:	FlpA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842
Orthologous TF(s)	Ldb0183, Ldb0482
Regulated genes	1

Built upon 32 sites [see more]

Predicted regulatory interactions in *Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842*
	Locus tag	Position	Score	Sequence
Position: -91 Score: 4.8 Sequence: AAGTTGATAGAAAACAATTT Locus tag: Ldb0480
	Ldb0480	-91	4.8	AAGTTGATAGAAAACAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copZ
Ortholog function: Copper chaperone
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_0428	-77	5.3	ATCTTGATAGAAATCAATTG
Lactobacillus fermentum IFO 3956	LAF_1466	-91	4.8	AAGTTGATAGAAAACAATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --