Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YtrA regulog to Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842

Reference regulog properties
Source regulog: YtrA - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842
Orthologous TF(s) Ldb1715
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842
Locus tag Position Score Sequence
Position: -50
Score: 6.7
Sequence: GTGTACTAGAATAAATAGTACAG
Locus tag: Ldb1715
Ldb1715 -50 6.7 GTGTACTAGAATAAATAGTACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Predicted transcriptional regulator, GntR family
Lactobacillus casei ATCC 334 LSEI_2244 -46 6.9 GTGTACTACGTATAATAGTACAC
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 LBUL_1589 -50 6.7 GTGTACTAGAATAAATAGTACAG
Oenococcus oeni PSU-1 OEOE_1803 -45 6.6 CTGTACTAATTAATATAGTACAC