Propagation of YtrA regulog to Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842
Source regulog: | YtrA - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Hypothetical ABC transporter |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 |
Orthologous TF(s) | Ldb1715 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -50
Score: 6.7 Sequence: GTGTACTAGAATAAATAGTACAG
Locus tag: Ldb1715
|
||||
Ldb1715 | -50 | 6.7 | GTGTACTAGAATAAATAGTACAG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ytrA | ||||
Ortholog function: Predicted transcriptional regulator, GntR family | ||||
Lactobacillus casei ATCC 334 | LSEI_2244 | -46 | 6.9 | GTGTACTACGTATAATAGTACAC |
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | LBUL_1589 | -50 | 6.7 | GTGTACTAGAATAAATAGTACAG |
Oenococcus oeni PSU-1 | OEOE_1803 | -45 | 6.6 | CTGTACTAATTAATATAGTACAC |