Propagation of NigR regulog to Lactobacillus johnsonii NCC 533
| Source regulog: | NigR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Nigerose utilization |
| Effector: | Nigerose-6-phosphate |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus johnsonii NCC 533 |
| Orthologous TF(s) | LJ0744 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -101
Score: 6.9 Sequence: AACTTAAAACGTTTCAAGTT
Locus tag: LJ0739
|
||||
| LJ0739 | -101 | 6.9 | AACTTAAAACGTTTCAAGTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nigB | ||||
| Ortholog function: Nigerose -specific PTS system, EIIB component | ||||
| Lactobacillus johnsonii NCC 533 | LJ0739 | -101 | 6.9 | AACTTAAAACGTTTCAAGTT |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1716 | -86 | 7 | AACTTGAAACGTTTAAAGTT |