Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NigR regulog to Lactobacillus johnsonii NCC 533

Reference regulog properties
Source regulog: NigR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus johnsonii NCC 533
Orthologous TF(s) LJ0744
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Lactobacillus johnsonii NCC 533
Locus tag Position Score Sequence
Position: -101
Score: 6.9
Sequence: AACTTAAAACGTTTCAAGTT
Locus tag: LJ0739
LJ0739 -101 6.9 AACTTAAAACGTTTCAAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nigB
Ortholog function: Nigerose -specific PTS system, EIIB component
Lactobacillus johnsonii NCC 533 LJ0739 -101 6.9 AACTTAAAACGTTTCAAGTT
Lactobacillus salivarius subsp. salivarius UCC118 LSL_1716 -86 7 AACTTGAAACGTTTAAAGTT