Propagation of YtrA regulog to Oenococcus oeni ATCC BAA-1163

Reference regulog properties
Source regulog:	YtrA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Oenococcus oeni ATCC BAA-1163
Orthologous TF(s)	OENOO_65019
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Oenococcus oeni ATCC BAA-1163*
	Locus tag	Position	Score	Sequence
Position: -33 Score: 6.6 Sequence: CTGTACTAATTAATATAGTACAC Locus tag: OENOO_65021
	OENOO_65021	-33	6.6	CTGTACTAATTAATATAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrB
Ortholog function: Predicted ABC transporter, ATP-binding protein
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_0053	-123	6.6	GTGTACTGTGTATTATAGTACAC
Oenococcus oeni PSU-1	OEOE_1805	-45	6.6	CTGTACTAATTAATATAGTACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --