Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Lactobacillus reuteri DSM 20016

Reference regulog properties
Source regulog: MntR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus reuteri DSM 20016
Orthologous TF(s) Lreu_1506
Regulated genes 1
Built upon 14 sites [see more]
Predicted regulatory interactions in Lactobacillus reuteri DSM 20016
Locus tag Position Score Sequence
Position: -89
Score: 4.8
Sequence: TTTTTATGTTACCCTAACAA
Locus tag: Lreu_1861
Lreu_1861 -89 4.8 TTTTTATGTTACCCTAACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Lactobacillus reuteri JCM 1112 LAR_1743 -89 4.8 TTTTTATGTTACCCTAACAA
© 2009-2020 RegPrecise