Propagation of NrtR regulog to Lactobacillus reuteri DSM 20016
| Source regulog: | NrtR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus reuteri DSM 20016 |
| Orthologous TF(s) | Lreu_0154 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -75
Score: 6.1 Sequence: TAAAAGTTAATCATACTTTTA
Locus tag: Lreu_0155
|
||||
| Lreu_0155 | -75 | 6.1 | TAAAAGTTAATCATACTTTTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pncB | ||||
| Ortholog function: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) | ||||
| Lactobacillus casei ATCC 334 | LSEI_2766 | -40 | 6.3 | TTTAAGTAAAAAATACTTTTA |
| Lactobacillus fermentum IFO 3956 | LAF_1391 | -54 | 6 | TTTAGGTATTTTTTACTTTAA |
| Lactobacillus helveticus DPC 4571 | lhv_0930 | -74 | 6 | TAAAAGTAACTTAGACTTTTA |
| Lactobacillus reuteri JCM 1112 | LAR_0148 | -75 | 6.1 | TAAAAGTTAATCATACTTTTA |
| Lactobacillus rhamnosus GG | LGG_02765 | -41 | 6.5 | TTTAAGTAAATTTTACTTTAA |