Propagation of NrtR regulog to Lactobacillus reuteri DSM 20016

Reference regulog properties
Source regulog:	NrtR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus reuteri DSM 20016
Orthologous TF(s)	Lreu_0154
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Lactobacillus reuteri DSM 20016*
	Locus tag	Position	Score	Sequence
Position: -75 Score: 6.1 Sequence: TAAAAGTTAATCATACTTTTA Locus tag: Lreu_0155
	Lreu_0155	-75	6.1	TAAAAGTTAATCATACTTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pncB
Ortholog function: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Lactobacillus casei ATCC 334	LSEI_2766	-40	6.3	TTTAAGTAAAAAATACTTTTA
Lactobacillus fermentum IFO 3956	LAF_1391	-54	6	TTTAGGTATTTTTTACTTTAA
Lactobacillus helveticus DPC 4571	lhv_0930	-74	6	TAAAAGTAACTTAGACTTTTA
Lactobacillus reuteri JCM 1112	LAR_0148	-75	6.1	TAAAAGTTAATCATACTTTTA
Lactobacillus rhamnosus GG	LGG_02765	-41	6.5	TTTAAGTAAATTTTACTTTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --