Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Lactobacillus reuteri DSM 20016

Reference regulog properties
Source regulog: Zur - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus reuteri DSM 20016
Orthologous TF(s) Lreu_1637
Regulated genes 1
Built upon 43 sites [see more]
Predicted regulatory interactions in Lactobacillus reuteri DSM 20016
Locus tag Position Score Sequence
Position: -36
Score: 6.8
Sequence: TAAATAGTAACGATTACGATTAA
Locus tag: Lreu_0216
Lreu_0216 -36 6.8 TAAATAGTAACGATTACGATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: Zinc ABC transporter, substrate-binding protein
Lactobacillus fermentum IFO 3956 LAF_0191 -48 6.7 TTAATCGTAAGGATTACGATTTA
Lactobacillus reuteri JCM 1112 LAR_0207 -36 6.8 TAAATAGTAACGATTACGATTAA
© 2009-2020 RegPrecise