Propagation of YwzG regulog to Lactobacillus brevis ATCC 367
| Source regulog: | YwzG - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Transport |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus brevis ATCC 367 |
| Orthologous TF(s) | LVIS_0242 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -36
Score: 7.1 Sequence: ATATTATACGTCGTATAGTAT
Locus tag: LVIS_0242
|
||||
| LVIS_0242 | -36 | 7.1 | ATATTATACGTCGTATAGTAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ywzG | ||||
| Ortholog function: Predicted transcriptional regulator, PadR family | ||||
| Lactobacillus brevis ATCC 367 | LVIS_0242 | -36 | 7.1 | ATATTATACGTCGTATAGTAT |
| Lactobacillus plantarum WCFS1 | lp_3216 | -37 | 7.1 | ATACTATACGACGTATAATAT |
| Lactobacillus reuteri JCM 1112 | LAR_0307 | -44 | 7.2 | ATATTATATGACATATAATAT |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_0105 | -59 | 6.9 | ATATTATATGATATATAATAT |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_2026 | -35 | 7.1 | ATATTATATGTCGTATAGTAT |
| Pediococcus pentosaceus ATCC 25745 | PEPE_1823 | -36 | 6.8 | ATACTATATGAGATATAGTAT |