Propagation of Lp_2742 regulog to Lactobacillus brevis ATCC 367

Reference regulog properties
Source regulog:	Lp_2742 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus brevis ATCC 367
Orthologous TF(s)	LVIS_0389
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Lactobacillus brevis ATCC 367*
	Locus tag	Position	Score	Sequence
Position: -46 Score: 6.7 Sequence: TTAATTACACAAGTAACTAA Locus tag: LVIS_0387
	LVIS_0387	-46	6.7	TTAATTACACAAGTAACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: lp_2739
Ortholog function: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
Lactobacillus brevis ATCC 367	LVIS_0387	-46	6.7	TTAATTACACAAGTAACTAA
Lactobacillus plantarum WCFS1	lp_2739	-59	6.8	TTAGTTACATAAGTAATTAA
Pediococcus pentosaceus ATCC 25745	PEPE_1743	-42	6.7	TTAGTTACACAAGTAATTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --