Propagation of MalR3 regulog to Lactobacillus brevis ATCC 367

Reference regulog properties
Source regulog:	MalR3 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus brevis ATCC 367
Orthologous TF(s)	LVIS_2178
Regulated genes	2

Built upon 17 sites [see more]

Predicted regulatory interactions in *Lactobacillus brevis ATCC 367*
	Locus tag	Position	Score	Sequence
Position: -108 Score: 5.5 Sequence: AAAAGCAAACGTTTGTGTAA Locus tag: LVIS_2178
	LVIS_2178	-108	5.5	AAAAGCAAACGTTTGTGTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malR3
Ortholog function: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
Lactobacillus brevis ATCC 367	LVIS_2178	-108	5.5	AAAAGCAAACGTTTGTGTAA
Lactobacillus plantarum WCFS1	lp_3625	-52	6.3	TTAAGCAAACGTTTGCTTAA

Position: -106 Score: 5.5 Sequence: TTACACAAACGTTTGCTTTT Locus tag: LVIS_2179
	LVIS_2179	-106	5.5	TTACACAAACGTTTGCTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: malT2
Ortholog function: Predicted maltose/maltodextrin permease
Lactobacillus brevis ATCC 367	LVIS_2179	-106	5.5	TTACACAAACGTTTGCTTTT
Lactobacillus plantarum WCFS1	lp_3533	-106	5.5	AAGTGTAAACGTTTACTTTA
		-74	5.8	TATTGTAAACGTTTACGTTA
Oenococcus oeni PSU-1	OEOE_0041	-59	6.1	TTTTGTAAACGTTTACTTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --