Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MtlR regulog to Lactobacillus casei BL23

Reference regulog properties
Source regulog: MtlR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: HPr, phosphocarrier protein; MtlA, mannitol-specific enzyme IICB PTS component
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus casei BL23
Orthologous TF(s) LCABL_31050
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Lactobacillus casei BL23
Locus tag Position Score Sequence
Position: -96
Score: 7.5
Sequence: TTTGGCACAGACAACTGTGCCAAA
Locus tag: LCABL_31060
LCABL_31060 -96 7.5 TTTGGCACAGACAACTGTGCCAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlA
Ortholog function: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
Lactobacillus casei ATCC 334 LSEI_2888 -96 7.5 TTTGGCACAGACAACTGTGCCAAA
Lactobacillus plantarum WCFS1 lp_0230 -104 6.7 TGTGGCACAGTTTCCTGTGCCACG
Lactobacillus rhamnosus GG LGG_02912 -96 7.2 TTTGGCACAACTAACTGTGCCAAA
Lactobacillus salivarius subsp. salivarius UCC118 LSL_1620 -110 6.9 TTTGACACTGACAACTGTGCCAAA