Propagation of RbsR regulog to Lactobacillus casei BL23
Source regulog: | RbsR - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Ribose utilization |
Effector: | Ribose |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus casei BL23 |
Orthologous TF(s) | LCABL_03210 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -45
Score: 6.7 Sequence: TAAGTAAAACGTTTTACCTA
Locus tag: LCABL_03210
|
||||
LCABL_03210 | -45 | 6.7 | TAAGTAAAACGTTTTACCTA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: rbsR | ||||
Ortholog function: Transcriptional repressor of ribose utilization, LacI family | ||||
Lactobacillus casei ATCC 334 | LSEI_0306 | -45 | 6.7 | TAAGTAAAACGTTTTACCTA |
Lactobacillus fermentum IFO 3956 | LAF_1343 | -44 | 6 | TTAGTAAACTGTTTTATTAA |
Lactobacillus reuteri JCM 1112 | LAR_1219 | -35 | 4.7 | TAGATAAAACTGTTTACTAA |
Lactobacillus rhamnosus GG | LGG_00372 | -46 | 6.7 | TAAGTAAAACGTTTTACCTA |
Lactobacillus sakei subsp. sakei 23K | LSA0203 | -49 | 6.9 | TTAGTAAAACGTTTTACTAA |
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_0795 | -123 | 6.6 | TTAGTAAAACGTTTAACCAA |
Oenococcus oeni PSU-1 | OEOE_0146 | -47 | 5.1 | TGTTGTAAACGTTTTAAGAA |