Propagation of FlpA regulog to Lactobacillus reuteri JCM 1112
Source regulog: | FlpA - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | CRP |
Regulation mode: | activator (repressor) |
Biological process: | Heavy metal resistance |
Effector: | Oxygen |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus reuteri JCM 1112 |
Orthologous TF(s) | LAR_1338, LAR_0962 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -69
Score: 5.7 Sequence: AAATTGATGATAATCAATTT
Locus tag: LAR_1340
|
||||
LAR_1340 | -69 | 5.7 | AAATTGATGATAATCAATTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: copZ | ||||
Ortholog function: Copper chaperone | ||||
Lactobacillus acidophilus NCFM | LBA0542 | -81 | 6 | AAATTGACGATCATCAAGTT |
Lactobacillus casei ATCC 334 | LSEI_0071 | -76 | 5.4 | AACTTGACGACGATCAAGGA |
Lactobacillus fermentum IFO 3956 | LAF_1701 | -68 | 5.1 | AAGTTGATGAGGATCAATTA |
Lactobacillus johnsonii NCC 533 | LJ1695 | -82 | 6 | AAATTGACGATCATCAAGTT |
Lactobacillus plantarum WCFS1 | lp_3442 | -75 | 6 | TTCTTGACGGCCGTCAAGTT |
Lactobacillus reuteri JCM 1112 | LAR_1340 | -69 | 5.7 | AAATTGATGATAATCAATTT |
Lactobacillus rhamnosus GG | LGG_00083 | -76 | 6 | AACTTGACGGCCATCAAGGT |
Lactobacillus sakei subsp. sakei 23K | LSA1783 | -79 | 6.1 | AACTTGATGGCGATCAATTT |
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1784 | -129 | 5.9 | AACTTGATATGCGTCAATTT |
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_A04 | -66 | 5.2 | TAATTGATCTATATCAAGTA |
Oenococcus oeni PSU-1 | OEOE_0354 | -126 | 6 | TTCTTGACGGCCGTCAAGTT |
Pediococcus pentosaceus ATCC 25745 | PEPE_0409 | -75 | 5.7 | AAATTGACCTACGTCAATTT |