Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YwzG regulog to Lactobacillus reuteri JCM 1112

Reference regulog properties
Source regulog: YwzG - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Transport
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus reuteri JCM 1112
Orthologous TF(s) LAR_0307
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Lactobacillus reuteri JCM 1112
Locus tag Position Score Sequence
Position: -44
Score: 7.2
Sequence: ATATTATATGACATATAATAT
Locus tag: LAR_0307
LAR_0307 -44 7.2 ATATTATATGACATATAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ywzG
Ortholog function: Predicted transcriptional regulator, PadR family
Lactobacillus brevis ATCC 367 LVIS_0242 -36 7.1 ATATTATACGTCGTATAGTAT
Lactobacillus plantarum WCFS1 lp_3216 -37 7.1 ATACTATACGACGTATAATAT
Lactobacillus reuteri JCM 1112 LAR_0307 -44 7.2 ATATTATATGACATATAATAT
Lactobacillus salivarius subsp. salivarius UCC118 LSL_0105 -59 6.9 ATATTATATGATATATAATAT
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 LEUM_2026 -35 7.1 ATATTATATGTCGTATAGTAT
Pediococcus pentosaceus ATCC 25745 PEPE_1823 -36 6.8 ATACTATATGAGATATAGTAT
© 2009-2020 RegPrecise