Propagation of MalR regulog to Lactobacillus reuteri JCM 1112
Source regulog: | MalR - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus reuteri JCM 1112 |
Orthologous TF(s) | LAR_0049 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -124
Score: 6 Sequence: TTGCGCAAGCGGTTGCGCAA
Locus tag: LAR_0051
|
||||
LAR_0051 | -124 | 6 | TTGCGCAAGCGGTTGCGCAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: malT | ||||
Ortholog function: Predicted maltose/maltodextrin permease | ||||
Lactobacillus brevis ATCC 367 | LVIS_0357 | -93 | 6.2 | TTGCGCAATCGGTTGCATTA |
Lactobacillus fermentum IFO 3956 | LAF_0024 | -122 | 6.6 | TTGTGCAAACGGTTGCACAA |
Lactobacillus reuteri JCM 1112 | LAR_0051 | -124 | 6 | TTGCGCAAGCGGTTGCGCAA |
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1282 | -117 | 6.3 | TATCGCAAACGGTTGCAAAA |
Pediococcus pentosaceus ATCC 25745 | PEPE_0968 | -86 | 6.1 | AAGTGCAAACGCTTGCACAA |