Propagation of YwzG regulog to Lactobacillus salivarius subsp. salivarius UCC118
Source regulog: | YwzG - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | PadR |
Regulation mode: | repressor |
Biological process: | Transport |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus salivarius subsp. salivarius UCC118 |
Orthologous TF(s) | LSL_0105 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -59
Score: 6.9 Sequence: ATATTATATGATATATAATAT
Locus tag: LSL_0105
|
||||
LSL_0105 | -59 | 6.9 | ATATTATATGATATATAATAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ywzG | ||||
Ortholog function: Predicted transcriptional regulator, PadR family | ||||
Lactobacillus brevis ATCC 367 | LVIS_0242 | -36 | 7.1 | ATATTATACGTCGTATAGTAT |
Lactobacillus plantarum WCFS1 | lp_3216 | -37 | 7.1 | ATACTATACGACGTATAATAT |
Lactobacillus reuteri JCM 1112 | LAR_0307 | -44 | 7.2 | ATATTATATGACATATAATAT |
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_0105 | -59 | 6.9 | ATATTATATGATATATAATAT |
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_2026 | -35 | 7.1 | ATATTATATGTCGTATAGTAT |
Pediococcus pentosaceus ATCC 25745 | PEPE_1823 | -36 | 6.8 | ATACTATATGAGATATAGTAT |