Propagation of YwzG regulog to Lactobacillus salivarius subsp. salivarius UCC118

Reference regulog properties
Source regulog:	YwzG - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Transport
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus salivarius subsp. salivarius UCC118
Orthologous TF(s)	LSL_0105
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Lactobacillus salivarius subsp. salivarius UCC118*
	Locus tag	Position	Score	Sequence
Position: -59 Score: 6.9 Sequence: ATATTATATGATATATAATAT Locus tag: LSL_0105
	LSL_0105	-59	6.9	ATATTATATGATATATAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ywzG
Ortholog function: Predicted transcriptional regulator, PadR family
Lactobacillus brevis ATCC 367	LVIS_0242	-36	7.1	ATATTATACGTCGTATAGTAT
Lactobacillus plantarum WCFS1	lp_3216	-37	7.1	ATACTATACGACGTATAATAT
Lactobacillus reuteri JCM 1112	LAR_0307	-44	7.2	ATATTATATGACATATAATAT
Lactobacillus salivarius subsp. salivarius UCC118	LSL_0105	-59	6.9	ATATTATATGATATATAATAT
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_2026	-35	7.1	ATATTATATGTCGTATAGTAT
Pediococcus pentosaceus ATCC 25745	PEPE_1823	-36	6.8	ATACTATATGAGATATAGTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --