Propagation of MntR regulog to Lactobacillus salivarius subsp. salivarius UCC118
Source regulog: | MntR - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus salivarius subsp. salivarius UCC118 |
Orthologous TF(s) | LSL_1481 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -87
Score: 5.2 Sequence: AGTTAAGGTAGACCTAAAAA
Locus tag: LSL_0904
|
||||
LSL_0904 | -87 | 5.2 | AGTTAAGGTAGACCTAAAAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntH | ||||
Ortholog function: Manganese transport protein MntH | ||||
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_0904 | -87 | 5.2 | AGTTAAGGTAGACCTAAAAA |