Propagation of NagR regulog to Lactobacillus fermentum IFO 3956

Reference regulog properties
Source regulog:	NagR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus fermentum IFO 3956
Orthologous TF(s)	LAF_0242
Regulated genes	1

Built upon 49 sites [see more]

Predicted regulatory interactions in *Lactobacillus fermentum IFO 3956*
	Locus tag	Position	Score	Sequence
Position: -47 Score: 5.1 Sequence: GAATTTATCTATACCAATTT Locus tag: LAF_0382
	LAF_0382	-47	5.1	GAATTTATCTATACCAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: glmS
Ortholog function: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Lactobacillus acidophilus NCFM	LBA0462	-28	4.2	ATATTGAACTAGACCAAAGG
Lactobacillus brevis ATCC 367	LVIS_0687	-106	5.1	ATTTCAGTCTATACCAATTT
Lactobacillus casei ATCC 334	LSEI_1019	-159	5.3	AAATTAATATAGACCAATAT
		-48	5	AAATCTGTCTAAACCAATTT
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_0440	-29	4.5	AAATTGAACTAGACCAAAGG
Lactobacillus fermentum IFO 3956	LAF_0382	-47	5.1	GAATTTATCTATACCAATTT
Lactobacillus helveticus DPC 4571	lhv_0491	-131	5.1	AAAATTGATTATACCAATTT
Lactobacillus johnsonii NCC 533	LJ1581	-130	5	CTTTTGATATAGACCAATTA
Lactobacillus reuteri JCM 1112	LAR_0405	-134	4.6	TAAATCATATAGACCAATCT
Lactobacillus rhamnosus GG	LGG_00983	-47	4.5	AAACCTGTCTAAACCAATTT
Lactobacillus sakei subsp. sakei 23K	LSA1355	-114	5.4	TAATTGAAATATACCAATAA
Lactobacillus salivarius subsp. salivarius UCC118	LSL_1627	-58	5	ATCAAGGTCTATACCAATTT
Oenococcus oeni PSU-1	OEOE_0635	-113	4.8	TTAATGGCCTATACCAATGT
Pediococcus pentosaceus ATCC 25745	PEPE_0478	-124	5	CATTTGATATATACCGATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --