Propagation of MdxR regulog to Lactobacillus gasseri ATCC 33323

Reference regulog properties
Source regulog:	MdxR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus gasseri ATCC 33323
Orthologous TF(s)	LGAS_0213
Regulated genes	2

Built upon 11 sites [see more]

Predicted regulatory interactions in *Lactobacillus gasseri ATCC 33323*
	Locus tag	Position	Score	Sequence
Position: -81 Score: 5.9 Sequence: TTTTGATACCGGTAACATTT Locus tag: LGAS_0214
	LGAS_0214	-81	5.9	TTTTGATACCGGTAACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: malL
Ortholog function: Oligo-1,6-glucosidase (EC 3.2.1.10)
Lactobacillus acidophilus NCFM	LBA1872	-78	5.4	TTTTGATACCGCTAACATCT
Lactobacillus casei ATCC 334	LSEI_0980	-82	5.4	TTTTGATAACGGTAACAAAC
Lactobacillus helveticus DPC 4571	lhv_2002	-63	5.6	TTTTGATACCGGTAACATCC
Lactobacillus johnsonii NCC 533	LJ0211	-81	5.5	TTTTGATACCGGTAACAGAT

Position: -96 Score: 5.9 Sequence: TTTTGATACCGGTAACATGA Locus tag: LGAS_0216
	LGAS_0216	-96	5.9	TTTTGATACCGGTAACATGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malK
Ortholog function: Maltose phosphorylase (EC 2.4.1.8)
Lactobacillus acidophilus NCFM	LBA1870	-104	5.7	TTCTGATACCGGTAACATGG
Lactobacillus casei ATCC 334	LSEI_0982	-129	5.8	TTATGATAGCGGTAACATTC
Lactobacillus johnsonii NCC 533	LJ0213	-100	6.1	TTTTGATACCGGTAACATTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --