Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NigR regulog to Lactobacillus gasseri ATCC 33323

Reference regulog properties
Source regulog: NigR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus gasseri ATCC 33323
Orthologous TF(s) LGAS_0519
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Lactobacillus gasseri ATCC 33323
Locus tag Position Score Sequence
Position: -102
Score: 7
Sequence: AACTTGAAACGTTTAAAGTT
Locus tag: LGAS_0514
LGAS_0514 -102 7 AACTTGAAACGTTTAAAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nigB
Ortholog function: Nigerose -specific PTS system, EIIB component
Lactobacillus johnsonii NCC 533 LJ0739 -101 6.9 AACTTAAAACGTTTCAAGTT
Lactobacillus salivarius subsp. salivarius UCC118 LSL_1716 -86 7 AACTTGAAACGTTTAAAGTT
© 2009-2020 RegPrecise