Propagation of SufR regulog to Synechococcus sp. WH 7805

Reference regulog properties
Source regulog:	SufR - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Synechococcus sp. WH 7805
Orthologous TF(s)	WH7805_11653
Regulated genes	1

Built upon 48 sites [see more]

Predicted regulatory interactions in *Synechococcus sp. WH 7805*
	Locus tag	Position	Score	Sequence
Position: -63 Score: 4.8 Sequence: AAACGAAACCAATGGGTTTCGTAT Locus tag: WH7805_11663
	WH7805_11663	-63	4.8	AAACGAAACCAATGGGTTTCGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ftrC
Ortholog function: Ferredoxin thioredoxin reductase catalytic chain
Synechococcus elongatus PCC 7942	Synpcc7942_1734	-101	5.1	TTTGACAACATTGATGTTGTTCAA
		-63	5.1	TTAAGCAACGTCTGTGTTGTTCAA
Synechococcus sp. WH 8102	SYNW0318	-39	4.9	TAAGGAAACCAGGTCGTTTCGTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --