Propagation of Zur regulog to Nodularia spumigena CCY9414
| Source regulog: | Zur - Cyanobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Cyanobacteria |
| Propagated regulon: | |
| Target genome | Nodularia spumigena CCY9414 |
| Orthologous TF(s) | N9414_07334 |
| Regulated genes | 5 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -250
Score: 5.7 Sequence: ATAAAAACGATAATCATTATGAC
Locus tag: N9414_19012
|
||||
| N9414_19012 | -250 | 5.7 | ATAAAAACGATAATCATTATGAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yciC2 | ||||
| Ortholog function: Putative zinc chaperone, COG0523 family | ||||
| Cyanothece sp. ATCC 51142 | cce_4857 | -50 | 5.8 | ATGAGATCAATTATCATTATCAT |