Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Nodularia spumigena CCY9414

Reference regulog properties
Source regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Propagated regulon:
Target genome Nodularia spumigena CCY9414
Orthologous TF(s) N9414_07334
Regulated genes 5
Built upon 84 sites [see more]
Predicted regulatory interactions in Nodularia spumigena CCY9414
Locus tag Position Score Sequence
Position: -250
Score: 5.7
Sequence: ATAAAAACGATAATCATTATGAC
Locus tag: N9414_19012
N9414_19012 -250 5.7 ATAAAAACGATAATCATTATGAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yciC2
Ortholog function: Putative zinc chaperone, COG0523 family
Cyanothece sp. ATCC 51142 cce_4857 -50 5.8 ATGAGATCAATTATCATTATCAT
© 2009-2020 RegPrecise