Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SmtB regulog to Cyanothece sp. PCC 7822

Reference regulog properties
Source regulog: SmtB - Cyanobacteria
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Propagated regulon:
Target genome Cyanothece sp. PCC 7822
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 16 sites [see more]
Predicted regulatory interactions in Cyanothece sp. PCC 7822
Locus tag Position Score Sequence
Position: -45
Score: 6.4
Sequence: AAAATATGAATAATCATTCATATATT
Locus tag: Cyan7822DRAFT_2893
Cyan7822DRAFT_2893 -45 6.4 AAAATATGAATAATCATTCATATATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ziaA
Ortholog function: Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)
Synechocystis sp. PCC 6803 slr0798 -80 6.5 AATATCTGAGCATATCTTCAGGTGTT
© 2009-2020 RegPrecise