Propagation of SmtB regulog to Thermosynechococcus elongatus BP-1

Reference regulog properties
Source regulog:	SmtB - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Thermosynechococcus elongatus BP-1
Orthologous TF(s)	tlr1018
Regulated genes	1

Built upon 16 sites [see more]

Predicted regulatory interactions in *Thermosynechococcus elongatus BP-1*
	Locus tag	Position	Score	Sequence
Position: -79 Score: 5.9 Sequence: GACGTATGAACAGTTGTTCAAGTATA Locus tag: tsl1016 (deprecated)
	tsl1016 (deprecated)	-79	5.9	GACGTATGAACAGTTGTTCAAGTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: smtA
Ortholog function: Metallothionein
Cyanothece sp. PCC 8801	PCC8801_0861	-71	6.9	AATATCTGAATACCTGTTCAGATGTT
Synechococcus elongatus PCC 7942	Synpcc7942_1290	-74	6.3	CATACCTGAATCAAGATTCAGATGTT
		-42	7.1	AACACATGAACAGTTATTCAGATATT
Synechococcus sp. PCC 7002	SYNPCC7002_A2563	-85	7.2	AATACCTGAATAATTGTTCATGTGTT
		-53	6.2	AAAATGTGAACAATCGTTCAACTATT
Thermosynechococcus elongatus BP-1	tsl1016 (deprecated)	-79	5.9	GACGTATGAACAGTTGTTCAAGTATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --