Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SmtB regulog to Nostoc sp. PCC 7120

Reference regulog properties
Source regulog: SmtB - Cyanobacteria
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Propagated regulon:
Target genome Nostoc sp. PCC 7120
Orthologous TF(s) alr0831, all7621 (deprecated)
Regulated genes 1
Built upon 16 sites [see more]
Predicted regulatory interactions in Nostoc sp. PCC 7120
Locus tag Position Score Sequence
Position: 13
Score: 6.4
Sequence: TACAATTGAATAGTTGTTCAATTGTT
Locus tag: alr7622 (deprecated)
alr7622 (deprecated) 13 6.4 TACAATTGAATAGTTGTTCAATTGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: alr7622
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Nostoc sp. PCC 7120 alr7622 (deprecated) 13 6.4 TACAATTGAATAGTTGTTCAATTGTT
© 2009-2020 RegPrecise