Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Synechococcus sp. JA-3-3Ab

Reference regulog properties
Source regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Propagated regulon:
Target genome Synechococcus sp. JA-3-3Ab
Orthologous TF(s) CYA_1383
Regulated genes 1
Built upon 84 sites [see more]
Predicted regulatory interactions in Synechococcus sp. JA-3-3Ab
Locus tag Position Score Sequence
Position: -39
Score: 5.7
Sequence: TTATGATTGATTATCATTCTCAT
Locus tag: CYA_2533
CYA_2533 -39 5.7 TTATGATTGATTATCATTCTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sufE
Ortholog function: Cysteine desulfuration protein
Synechococcus sp. JA-3-3Ab CYA_2533 -39 5.7 TTATGATTGATTATCATTCTCAT
© 2009-2020 RegPrecise